Gene Promoter Analysis using Luciferase reporter assay (Ligation, mammalian cell culture, transfection, luciferase assay)

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

The pGL3 Luciferase reporter vector (Promega, Madison, WI, USA) was used for a quantitative analysis of a sequence variant found in a potential site that might affect the expression of TRAF6 gene. The pGL3 enhancer (e) vector (Figure 1) was redesigned for increased expression and contains the coding region of luciferase which is useful to monitor and quantify transcription in eukaryotic cells.

 

Figure 1. pGL3 enhancer vector (Promega, Madison, WI, USA) showing multiple cloning site, modified luciferase gene (luc+) and the gene for ampicillin resistance (Ampr)

 

DNA Cloning

Preparation of Constructs

            Three constructs, of variable lengths, lying upstream of the transcriptional start site were designed and amplified by PCR. The sequence variant being investigated was included into each construct. PCR primers shown in Table 1 were designed using OligoExplorer v1.2 and tagged at the 5` end by a specific restriction site and a non-complementary tail. Using different restriction enzymes to cut constructs and plasmid, leaving complementary sticky ends, allows unidirectional cloning of the fragments into the reporter vector.

 

Table 1 Oligonucleotide Primers used for Constructs

 

Primer Sequence (5` - 3`)

Fragment Size (bp)

Construct 1 (Fwd)

CAATGCGGAGGTACCCAAATTCCTGGCCTCAAGTGA

1002

Construct 2 (Fwd)

CAATGCGGAGGTACCCACCACCACACCCAGGTAA

1073

Construct 3 (Fwd)

CAATGCGGAGGTACCGGAGCTTCTAGGGAGGGATA 

1490

Reverse Primer*

TGAACTTGCAGCTAGCCACTGCTTCCGCCTTCTCT

 

*Reverse Primer is common for all constructs and has an NheI restriction site (red and underlined)

Specific parts of primers are shown in bold

All forward primers have a KpnI restriction site (red and underlined)

 

 

PCR was performed to amplify both normal and mutated alleles. All PCR reactions were performed in a total volume of 100 µl, containing 50 mM ammonium sulphate (pH 9.3), 2.5 mM MgCl2, 1% Tween 20, 400 µM dNTP, 25 ρmol of each primer, 5 U REDAccuTaq™ LA DNA polymerase mix (Sigma-Aldrich, Missouri, USA) and 100ng genomic DNA. The DNA used for the PCR reaction was that of a heterozygous individual for the variant being studied. All tubes were then placed in a thermal cycler (GeneE, Techne Ltd, Cambridge, UK).

An initial denaturation step at 98°C for 30 sec was carried out followed by thirty cycles starting with denaturation at 95°C for 1 minute, annealing/extension at 68°C for 3 minutes. A final extension at 68°C for 10 minutes was performed at the end of cycling. The PCR products were checked using 1% agarose gel electrophoresis (Figure 2) and stored at -20°C until further analysed.

 

Figure 2. PCR optimisation of constructs showing Φx174 HaeIII (A); B to E construct 1; F to I construct 2; J to M construct 3.

 

 

Cleaning and digestion

            All PCR products were cleaned to remove any excess primers, nucleotides and buffers as described in sequencing section. All fragments were sequenced as described before restriction digestion was performed to identify any errors that might have been introduced by the polymerase. All PCR products and pGL3e vector were double digested using restriction enzymes KpnI and NheI (New England Biolabs, Beverly, MA, USA) in a 50 µl reaction.

Using calibrated pipettes, 1 µl (250 ng) of vector was added to a sterile tube containing 10 units of each restriction enzyme, 0.5µl (5µg) acetylated bovine serum albumin, 5 µl NE Buffer 1 (New England Biolabs, Beverly, MA, USA) and made up to a total volume of 50 µl. A similar reaction mix was prepared for each construct by adding 40 µl of each PCR product followed by the addition of the other components as described for vector digestion. All tubes were incubated overnight at 37°C.

 

Vector de-phosphorylation

After incubation, the digested vector was treated with Antarctic phosphatase (New England Biolabs, Beverly, MA, USA) to remove 5` phosphate groups thus preventing any possibility of self ligation. A reaction mixture was prepared by adding 5 µl reaction buffer (50 mM Bis Tris-Propane; 1 mM MgCl2; 0.1 mM ZnCl2; pH 6.0 @ 25°C), followed by the addition of 1 μl Antarctic phosphatase (5 U), 40 μl digested vector and made up to 50 μl with sterile distilled water. Incubation was carried out for 15 minutes at 37°C followed by enzyme deactivation at 65°C for 20 minutes.

Both de-phosphorylated vector and digested constructs were electrophoresed on a 1% agarose gel, prepared as described above, using one inch wells. Electrophoresis was carried out at a voltage of 36 V with variable current for 30 minutes. The gels were then visualised under UV irradiation very quickly to avoid damaging the fragments by UV exposure. The linearized plasmid appears as a single band of approximately 5 kb. Smaller bands might also appear showing supercoiled plasmid due to incomplete digestion.

 

Gel cleaning of constructs and plasmids

            All fragments were extracted and purified from agarose gel using the StrataPrep® DNA gel extraction kit (Stratagene, La Jolla, CA, USA). This method uses a microspin cup with silica fibre to bind DNA that is cleaned and finally eluted from the fibre matrix using a low ionic strength buffer. Using a clean surgical blade, the fragments were cut from the gel and placed in a labelled sterile 1.5 ml microcentrifuge tube, which was previously weighed on a calibrated analytical balance. Following the addition of the gel piece, the tube was weighed again and the difference in weight recorded. The average weight of gel slices containing digested constructs and vector was 200 mg.

            300 μl of DNA extraction buffer were added to each 100 mg of gel slice. The mixture was heated to 50°C for 10 minutes with occasional mixing. During this step the gel dissolved and DNA was extracted into the buffer. Following incubation, the mixture was transferred into a microspin cup that was placed inside a 2 ml receptacle tube. The tubes were then centrifuged (Eppendorf centrifuge 5417R, Hinz GmbH, Hamburg, Germany) at 16,000 g for 30s. The DNA was retained in the fibre matrix of the microspin cup and excess gel was removed.

The tubes were placed in a rack and the liquid within the receptacle tube was discarded while keeping the microspin cup. 750 μl of 1 x wash buffer (containing ethanol) were added with a pipette to the microspin cup that was capped and centrifuged at 16,000 g for 30 sec. Following centrifugation, the wash buffer that collected in the receptacle tube was discarded keeping the microspin cup, which was again placed in the receptacle tube and centrifuged as before to remove any excess buffer.

The microspin cup was removed from the receptacle tube and placed in a new sterile 1.5ml microcentrifuge tube. Fifty micro litres of sterile deionised water (heated to 70°C) were added to the microspin cup followed by incubation for 5 minutes at room temperature. Following incubation, the tubes were centrifuged at 16,000 g for 30 seconds to elute the DNA from the fibre matrix. The purified DNA collected in the 1.5 ml tubes was stored at -20°C until analysed.

 

Ligation reaction

            The cleaned double digested constructs and plasmids, with complementary sticky ends, were recombined together in a reaction using T4 DNA ligase and adenosine triphosphate (ATP). Four different reactions were prepared for each construct containing different ratios (1:3; 1:1; 3:1; 1:7) of restricted vector and insert. The gel purified plasmid and inserts were quantified by spectrophotometry as described (Section 2.3.1). The amount of vector and insert to be used for ligation was calculated by conversion of molar ratios to mass ratios using the following equation (for 3:1 vector:insert ratio):

 

ng vector X  kb size of insert   x 3 = ng of insert

             kb size of vector               1

 

The appropriate amounts of vector and constructs were added to 0.2ml sterile microcentrifuge tubes, which were placed on ice during the whole procedure. One micro litre of 10X ligase buffer containing 300 mM Tris-HCl (pH 7.8), 100 mM MgCl2, 100 mM dithiothreitol (DTT) and 10 mM ATP (Promega, Madison, WI, USA) was added into each tube followed by the addition of 3 U T4 ligase (Promega, Madison. WI, USA) and topped up to 10 μl with sterile water. Controls were prepared in the same manner. Six insert-only controls (one for each insert) were prepared without the addition of vector while a vector only control was prepared separately (Table 2). Incubation was carried out overnight at 4°C in a refrigerator.

 

Table 2. Ligation Reaction Mix Preparation

 

1:3

1:1

3:1

1:7

Insert Only

Empty Vector

pGL3

n

n

3n

n

-

4 µl

Construct

3n

n

n

7n

4 µl

-

T4 Ligase

1 µl

1 µl

1 µl

1 µl

1 µl

1 µl

10X Buffer

1 µl

1 µl

1 µl

1 µl

1 µl

1 µl

Water

Up to 10 µl

Up to 10 µl

Up to 10 µl

Up to 10 µl

4 µl

4 µl

*n is the volume used in µl calculated after quantification of plasmid and constructs’ concentrations

 

Preparation of competent cells used for transformation

            Competent cells (DH5α) (Invitrogen Ltd, UK) were transformed with recombinant constructs (vector + insert). DH5α are modified Escherichia coli capable of being efficiently transformed by fairly large plasmids using a heat shock protocol. A 5µl loop was used to streak a Luria Bertani (LB) (Sigma L-2897, Sigma-Aldrich, Missouri, USA) agar plate without addition of antibiotic. The plate was incubated overnight at a temperature of 37°C. A single colony was selected and transferred to 10 ml LB broth (Sigma cat# L-3022, Sigma-Aldrich, Missouri, USA) in a sterile universal container without antibiotic and incubated overnight at 37°C in a shaking incubator at 250 rpm.

            A 1-litre conical flask containing 100 ml of LB broth was inoculated with 2 ml from the previous 10 ml broth after incubation. The 1-litre flask was incubated in a shaking incubator at 250 rpm and a temperature of 37°C. During incubation 1 ml aliquots were taken aseptically every hour and their turbidity was read by spectrophotometry at 600 nm using LB broth as blank. This was done until an optical density of 0.5 was reached. The 100 ml broth was transferred into two 50 ml conical centrifuge tubes and chilled on ice for 10 minutes followed by centrifugation at 3,000 g for 20 minutes. Following centrifugation, the supernatant was removed carefully not to disturb the cell pellet, which was drained well by tapping the tube on absorbent paper. The tube containing the cell pellet was kept always on ice.

            Each pellet was re-suspended in 10 ml ice-cold 100mM magnesium chloride and incubated on ice for 10 minutes followed by centrifugation for 10 minutes at 3,000 g. The cell pellets were drained as before, re-suspended in 10 ml of ice-cold 100mM calcium chloride and incubated for 30 minutes on ice. The tubes were centrifuges again at 3,000 g for 10 minutes; the pellet was drained and re-suspended in 1 ml of ice-cold 100mM calcium chloride with 15% glycerol (v/v). Aliquots of 200 µl each were prepared in pre-chilled cryo-tubes and stored at -80°C until needed.

 

Transformation

Cells were removed from -80°C storage and allowed to thaw on ice. After thawing cells were mixed by simple inversion. Luria Bertani (LB) (Sigma cat# L-2897, Sigma-Aldrich, Missouri, USA) agar plates containing 100 µg/ml ampicillin, were removed from refrigeration and allowed to dry for fifteen minutes. Two plates were used for each ligation/transformation reaction.

A transformation mixture was prepared by adding 5µl of ligation reaction to 50 µl of DH5α competent cells. The tubes were mixed gently and placed on ice for 20 minutes. Following incubation, the cells were heat-shocked for 45 – 50 seconds at 42°C in a heating block and placed again on ice for another 2 minutes. During this step, the plasmids enter the bacteria through their weak cell wall.

Using a calibrated pipette, 950µl of LB broth, without antibiotic, (refer to appendix for preparation) were added into each tube and mixed gently. The mixture was transferred to a labelled 20ml sterile universal bottle and incubated for 1.5 hours at 37°C in a shaking incubator at 150 rpm (Stuart SI50). During this step, successfully transformed competent cells recuperate and start producing β-lactamase.

Two LBAmp100 plates were prepared for each transformation and labelled as high or low according to high or low concentration plating. Following the 1.5 hours incubation, 150 µl of each transformant broth were added into corresponding plates labelled low, and spread using a sterile spreader. The remaining transformant broths were centrifuged at 2,600 g for 5 minutes to pellet the cells. After centrifugation, the supernatant were discarded and the pellet was re-suspended in the remaining 150 µl of broth. The LB agar plate labelled high was inoculated by this amount and both plates incubated overnight at 37°C.

After incubation, the plates were inspected for colonies, comparing high and low concentration plates, individually. Any colonies visible were resistant to ampicillin due to production of β-lactamase after transformation. Vector and insert control plates were also observed. No growth was observed on these plates. Any growth on vector control plates might indicate contamination, incomplete restriction or re-ligated restricted vectors. One plate for each construct was selected for the remainder of the procedure.

Ten universal sterile containers were prepared for each construct plate to which 5 ml of LB broth were added followed by the addition of 5 µl ampicillin (100 mg/ml stock solution). Using sterile tips, ten colonies were individually selected from each plate and transferred to the respective universal container containing LBAmp100 broth. The broths were incubated overnight at 37°C in a shaking incubator (Stuart SI50) at 200 rpm.  

Following incubation, any broths that failed to grow were discarded. An LBAmp100 agar plate was labelled for each successful broth in order to isolate single colonies that can be easily selected. Using a sterile loop, an LBAmp100 plate was streaked as shown in Figure 3, followed by an overnight incubation at 37°C. The rest of the broths were stored at 4°C.

 

Figure 3. A single colony streak plate showing (a) initial pool (b) streak out from pool thus diluting bacteria (c) further streaking out. Arrow indicates direction of streaking while turning plate anticlockwise

 

            The next day, the plates were investigated for growth and a single colony was selected from each plate using a sterile pipette tip and transferred to a 20ml sterile container containing 5ml of LBAmp100 broth and incubated overnight in a shaking incubator at 200 rpm and temperature of 37°C. 

 

Plasmid extraction and preparation of glycerol stocks

            After the overnight incubation, 1.5 ml of each successful broth containing transformed E. coli were added to a 1.5 ml sterile microcentrifuge tube and centrifuged at 10,000 g for 5 minutes to pellet the cells. Following centrifugation, the supernatant was discarded and another 1.5ml broth were added and centrifuged as before. The supernatant was removed again and the tubes were inverted and left to dry on a clean absorbent paper for 20 minutes to remove excess broth that might interfere with further testing.

             Plasmid extraction from transformed cells was carried out using the Wizard® Plus SV minipreps DNA purification system (Promega, Madison, WI, USA). 250 µl of cell suspension solution (50 mM Tris-HCl pH 7.5; 10 mM EDTA; 100 µg/ml RNase A) were added into each tube and mixed thoroughly to re-suspend the pellet, followed by the addition of 250 µl of cell lysis solution (0.2 M NaOH; 1% SDS). The tubes were inverted four times and incubated at room temperature for not more than five minutes until the cell suspension clears. Using a calibrated pipette, 10µl of alkaline protease were added into each tube, mixed and incubated for another five minutes at room temperature.  Alkaline protease inactivates endonucleases released during lysis of bacterial cells that can affect the quality of DNA. Following incubation, 350 µl of neutralisation solution (4.09 M guanidine hydrochloride; 0.759 M potassium acetate; 2.12 M glacial acetic acid; pH 4.2) were added into each tube and immediately mixed by inversion. All tubes were centrifuged at 14,000 g in a microcentrifuge tube for 10 minutes at room temperature.

            Following centrifugation, the clear lysate was decanted into a spin column avoiding the disturbance of the white precipitate, followed by centrifugation at 14,000 g for 1 minute. The flow-through was discarded and the column returned into the collection tube. 750 µl of column wash solution, previously diluted with 95% ethanol (60% ethanol; 60 mM potassium acetate; 8.3 mM Tris-HCl; 0.04 mM EDTA), were added into each spin column and centrifuged as before. After discarding the flow-through, the wash procedure was repeated again by adding 250 µl of wash solution followed by centrifugation as before. The spin column was transferred into a new sterile 1.5 ml microcentrifuge tube and the plasmid DNA was eluted by adding 100 µl of pre-heated nuclease free water (60°C) to the column, which was left to stand for 5 minutes and centrifuged at 14,000 g for 1 minute. The eluted plasmid DNA was stored at -20°C until analysed.

            Glycerol stocks from single colonies were prepared by adding 500 µl of single colony broth to 500 µl of 50% glycerol into a 1.5 ml cryo-tube followed by mixing and immediate storage at -80°C. 

 

Restriction digestion and sequencing of plasmid DNA

            Extracted plasmid DNA was double digested to confirm that the construct was recombined with the plasmid. Plasmids with inserted constructs were also sequenced to select both those having the variant being investigated and normal alleles and to check the integrity of the fragment (by the absence of any random errors introduced by the polymerase).

            Five micro litres of plasmid DNA were added into a 0.2 ml PCR tube followed by the addition of 1.2 µl of NE Buffer 1 (New England Biolabs, Beverly, MA, USA), 0.12 µl acetylated BSA (10 µg/µl), 2.5 U of each restriction enzyme KpnI and NheI (New England Biolabs, Beverly, MA, USA) and topped up to 12 µl with sterile distilled water. Incubation was carried out at 37°C for 18 hours. Following incubation, electrophoresis was carried out on a 1% agarose gel for 20 minutes at a voltage of 100 V with variable current. The gel was visualised by UV irradiation and photographed. Any colonies that were successfully transformed with vector-containing insert appeared to have two bands following digestion (Figure 4). Colonies that were not transformed with insert were discarded.

 

Figure 4. 1% agarose gel showing (A) ΦX174/HaeIII size marker;  (B,C,D) Plasmid DNA (upper fragment) and insert 1 (lower fragment); (E,F) Plasmid DNA with insert 2; (G) Plasmid DNA with insert 3; (H)  super coiled undigested plasmid (SC)

 

            Plasmids with inserted constructs were sequenced, using primers specific for the pGL3 enhancer vector (GLprimer2: 5` CTT TAT GTT TTT GGC GTC TTC CA 3`; RVprimer3: 5` CTA GCA AAA TAG GCT GTC CC 3`) and forward primer TRAF6-Prom 1 shown in Table in sequencing section (used to confirm the presence of normal or mutated allele) (Figure 5).

 

        

Figure 5. Electropherograms of normal (left) and mutated (right) alleles sequenced from cloned bacterial colonies.

 

Plasmid DNA extraction for transfection

            Ultra pure plasmid DNA suitable for transfections was extracted using a QIAGEN HiSpeed Plasmid Maxi Kit (QIAGEN GmbH, Hilden, Germany). Plasmid DNA was extracted from E. coli by subjecting the cells to alkaline lysis followed by binding of plasmid DNA to an ion-exchange column. Proteins, RNA and other impurities were removed by a low salt buffer. Plasmid DNA was eluted using a high salt buffer and then concentrated and desalted by isopropanol. This method does not require the use of ultra centrifugation or of any toxic reagents.

            The glycerol stocks prepared from selected colonies were thawed on ice and one loop full was used to inoculate a 5 ml LBAmp100 broth followed by an overnight incubation in a shaking incubator at 250 rpm and temperature of 37°C. Following incubation a 1/500 dilution from starter culture was prepared by adding 300µl of culture into a 150 ml of sterile LBAmp100 broth in a 1,000 ml sterile conical flask. The cultures were incubated for not more than 16 hours in a shaking incubator at 37°C and 250 rpm. Incubation time is important as this is the time of the transition between the logarithmic and stationary phases. Longer incubations may increase the chance to introduce plasmid mutations. After incubation the broths were transferred into appropriate 50 ml conical centrifuge tubes and bacterial cells were harvested by centrifugation at 3,000 g for 30 minutes at 4°C. The supernatant was discarded and the tubes were inverted and tapped several times on an absorbent tissue to remove any excess broth. The cell pellets were stored at -20°C until required.

            After thawing, the bacterial cell pellet was resuspended in 10 ml of resuspension buffer (50 mM Tris-Cl, pH 8.0; 10 mM EDTA; 100 µg/ml RNase A), vortexing the tube to ensure complete resuspension of bacteria. Ten millilitre lysis buffer (200 mM NaOH; 1% SDS w/v) were added to the tube several times followed by incubation at room temperature for not more than 5 minutes. Following incubation, 10 ml of pre-chilled neutralisation buffer (3.0 M potassium acetate; pH 5.5) were added and mixed by vigorously inverting the tube several times. A white precipitate was formed after the addition of neutralisation buffer containing genomic DNA, proteins and cell debris. The lysate was poured into a QIAfilter cartridge and incubated at room temperature for 10 minutes without disturbing. The white precipitate floated to the surface forming a layer on top of a clear solution.

            During incubation, a HiSpeed Maxi tip filter column was placed in a stand and equilibrated by adding 10ml of equilibration buffer (750 mM NaCl; 50 mM MOPS, pH 7.0; 15% isopropanol v/v; 0.15% Triton® X-100 v/v). The buffer was allowed to drain through the filter on its own. Following incubation, a syringe plunger was inserted into the QIAfilter cartridge and the lysate was passed through it into the HiSpeed Maxi filter column by applying constant pressure. The lysate was allowed to pass through the filter by gravity, after which the column was rinsed with the addition of 60 ml of wash buffer (1.0 mM NaCl; 50 mM MOPS, pH 7.0; 15% isopropanol v/v).

After washing, 15ml of pre-warmed (60°C) elution buffer (1.25 M NaCl; 50 mM Tris-Cl, pH 8.5; 15% isopropanol v/v) were added to the column. The eluted DNA was collected in a sterile universal container and was precipitated by the addition 10.5ml of room temperature isopropanol. The solution was mixed and incubated for 5 minutes at room temperature.

During incubation, the plunger of a sterile 30 ml syringe was removed and a QIAprecipitator filter device was attached onto the outlet nozzle. Following incubation, the mixture of eluate/isopropanol was transferred to the syringe and the plunger was inserted. The mixture was filtered through the QIAprecipitator by applying constant pressure. The filter was removed before the plunger was pulled out, and then attached again to the nozzle. The DNA was washed by the addition of 2 ml of 70% ethanol to the syringe, which was passed through the filter. This step was repeated twice followed by drying of the filter on an absorbent material to remove any excess ethanol.

The QIAprecipitator filter was attached to the nozzle of a new 5 ml syringe and 1 ml of sterile distilled water was added to the syringe. The DNA was eluted into a collection tube by applying a constant pressure on the plunger. The eluate was transferred again to the syringe and eluted for the second time. DNA concentration was measured by spectrophotometry as described in Section 2.3.1 using an Eppendorf Biophotometer (Eppendorf AG, Hamburg, Germany). Plasmid DNA having low concentrations were concentrated by drying for 4 hours in a vacuum centrifuge (Savant SpeedVac concentrator SVC100H, Savant Instruments Inc, Farmingdale, NY) to a final volume of 500 µl. The final DNA concentrations were between 200 – 400 µg/ml with a DNA:Protein ratio of 1.8 – 1.9. Eluted DNA was stored at -20°C until needed.

 

TRAF6 Gene Promoter Variant Analysis – mammalian cell preparation

A dual reporter system was used to investigate gene expression in eukaryotic cells as affected by the activity of the TRAF6 gene promoter region previously cloned in the pGL3 enhancer reporter plasmid.  Dual reporters improve experimental accuracy by measuring the simultaneous expression of the experimental reporter and control. Experimental and control reporters were co-transfected into cultured cells where the control was used to normalize the experimental reporter and thus minimizing experimental variability due to transfection efficiency and cell viability. In this system, the activity of the firefly luciferase was used as reporter while that of the Renilla luciferase as control. The assay was done in a single tube, by first quantifying the reporter followed by control with an intermediate addition of a quencher.

 

Cell Culture

            HeLa cells were obtained from the cell culture collection at the Anatomy and Cell Biology Department, University of Malta. The murine macrophage cell line RAW 264.7 (ICLC ATL02001) was purchased from the Interlab Cell Line Collection, Institute of Cancer Research, Genova, Italy (http://www.iclc.it/index.html).

 

Preparation of Culture Medium

            Dulbecco’s Modified Eagle’s Medium (DMEM) (Sigma, Saint Louise, Missouri, USA) containing 4 mM L-glutamine and 4.5 g/L glucose (Sigma cat# D5648) was used to culture both cell lines. This modified formula contains a higher concentration of vitamins and amino acids as well as a higher glucose concentration. If not stated otherwise, this medium was used throughout the whole procedure.

            The powdered medium was dissolved in 900 mls of distilled water by stirring. The empty bottle was also rinsed with distilled water to completely remove all traces of powdered medium. 3.7 g of sodium bicarbonate were added and dissolved and distilled water was finally added to a final volume of 1 litre. The medium was sterilised by filtration using a 0.2µm membrane filter flask and stored at 4°C in a refrigerator.

 

 Cell Thawing

            Thawing of cells from storage in liquid nitrogen was done rapidly by placing the cryogenic tube into a water bath at 37°C for a couple of minutes. The tube was then transferred into a class II safety cabinet and wiped from the outside with 70% alcohol. Using an aseptic technique, the cells were transferred into a sterile conical centrifuge tube to which 10 ml of Dulbecco’s Modified Eagle’s Medium (DMEM) containing 10% foetal calf serum (FCS) and 4 mM L-glutamine were added. The tube was centrifuged at 100 g for 10 minutes. This step was performed to dilute and remove the dimethyl sulfoxide (DMSO) used for storage that can damage the cells. Following centrifugation, the supernatant was removed and the cell pellet re-suspended in 5 ml DMEM containing 4 mM L-glutamine and 10% FCS. Antibiotics were added to the medium to a final concentration of 5 U/ml penicillin and 5 mg/ml streptomycin. The cell suspension was transferred into a 25 cm2 tissue culture flask and incubated at 37°C and 5% CO2. After 24 hours the culture was inspected under an inverted microscope to observe viability and confluency. Cells were passaged into two 75cm2 tissue culture flasks when 80 – 90% confluency was attained, and grown in 15 ml of DMEM (10% FCS).

 

Passaging (splitting) of Cells

            Both cell lines used in this study grow as a monolayer attached to the plastic bottom of the tissue culture flask. When the cells become confluent growth slows down and ceases. So to keep the cells healthy and actively growing, sub-culturing is necessary at regular intervals. This process involves the use of an enzyme, usually trypsin, which breaks the anchorage between the cells, to loosen and make them very easy to remove.

            Culture medium and Trypsin-EDTA (0.5% porcine trypsin / 0.2% EDTA.4Na) solution were pre-warmed at 37°C in an incubator. The tissue culture flask was transferred into a class II safety cabinet that was previously cleaned with 70% alcohol and treated with UV irradiation. An aseptic technique was used throughout the whole procedure. Using a sterile pipette, the old medium was removed and transferred to a sterile centrifuge tube. The cell monolayer was washed briefly with 2 – 3 ml of pre-warmed trypsin-EDTA solution to remove excess DMEM containing FCS from cell surfaces. This wash solution was quickly removed using a sterile pipette followed by the addition of 2 ml of the trypsin solution onto the cell surface while swirling the flask to cover the entire surface. The tissue culture flask was placed in the incubator at 37°C for 2 minutes. The flask was observed for cell detachment by using an inverted microscope, where the cells were observed to round up and detach. The flask was tapped on the sides to completely detach the cells. Trypsinisation was not carried out for more than 10 minutes.

            Using a sterile pipette, 5 ml of pre-warmed sterile DMEM containing 10% FCS were added to the cell suspension since the FCS inactivates the trypsin. The suspension was mixed by pipetting and transferred into a sterile 15 ml conical centrifuge tube. The suspension was centrifuged at 100 g for 5 minutes. Following centrifugation, the tube was transferred into the class II cabinet and the supernatant decanted leaving the cell pellet and some residual medium. The pellet was gently tapped and 5 ml of DMEM containing 4 mM L-glutamine and 10% FCS, were added to the suspended pellet and mixed gently. A small aliquot was taken from the cell suspension for counting, as described below. After cell counting, the cell suspension was diluted to a minimum of 2 × 104 cells / ml using fresh pre-warmed DMEM and 10% FCS. Passaging was performed every 2 to 3 days and a 1:5 split was done in T-75 flasks containing 15 ml culture suspension. The flasks were swirled gently on the bottom to disperse the cells and incubated at 37°C and 5% CO2. The cells were observed daily, macroscopically and microscopically, for any evidence of bacterial or fungal contamination and to evaluate their viability.

 

Cell Counting

            A small aliquot of cell suspension was transferred to a 1.5 ml microcentrifuge tube. The improved Neubauer haemocytometer was used for cell counting, which consists of two chambers divided into nine 1 mm squares holding 0.1 µl each. The haemocytometer was cleaned with water, rinsed with 70 % alcohol and wiped dry. A cover slip was placed on the haemocytometer and each chamber was loaded with a drop of the mixed cell suspension allowing capillary action to withdraw the suspension inside the chamber.

            Using a light microscope with 100 X magnification, the cells were counted in the four large corner squares and the central large square. Both chambers were counted and recorded. The cell count per ml was calculated as follows:

 

Number of cells/ml = (Total count ÷ number of large squares counted) × 104

 

Cryopreservation of Cells

            Reserves of cells were stored in liquid nitrogen in order to maintain their integrity and viability. Long term storage of mammalian cells is best done at temperatures lower than -130°C, usually at around -175°C just above liquid nitrogen but not directly in it. The use of DMSO or glycerol helps in cryopreservation.

            The culture was first observed under an inverted microscope for any microbial contamination. An actively growing culture at around 80% confluency was trypsinized, as described above. Counting of cells was done as described above and cryogenic vials containing approximately 2 × 106 cells suspended in antibiotic free DMEM were prepared. The cryogenic medium consisted of 10% DMSO and 50% FCS topped up to 1.5 ml with antibiotic free DMEM.

            The cells were first transferred to a -80°C freezer and left overnight, after which they were transferred for long term storage in liquid nitrogen.

 

Transient Transfection

            Transient transfection refers to the introduction of DNA into eukaryotic cells to study mammalian gene function and control. The six constructs of the TRAF6 promoter region were transfected into HeLa and RAW 264.7 cell lines using the cationic lipid transfection reagent Tfx™-20 (Promega, Madison, WI, USA). This reagent consists of a mixture of fusogenic lipid and L-dioleoyl phosphatidylethanolamine (DOPE) that upon hydration forms multilamellar vesicles that associate with the negatively charged DNA creating a net positive charge. The positively charged vesicles will interact with the negatively charged cell membrane and enter the cell by endocytosis.

 

Day 1

            The day before transfection, the transfection reagent was reconstituted as follows. The reagent was brought to room temperature and using an aseptic technique, 400 µl of nuclease free water were added to a final concentration of 1 mM. The vial was closed and vortexed vigorously for 10 sec followed by heating at 65°C in a water bath for 1 minute. The vial was vortexed again for 10 sec and stored at -20°C overnight.

            Plating of cells was also done the day before transfection in order to obtain an 80% confluent culture on the day of transfection. Cells were harvested from a healthy growing culture as described above and a cell count was performed. Only cells with less than 10 passages were used for all transfections. The cells were diluted in pre-warmed antibiotic free DMEM with 4 mM L-glutamine and 10% FCS to a final concentration of 1 × 105 cells / ml. 500 µl from the cell suspension was added into each of the 24 well plates, adding approximately 5 × 104 cells / well. For each assay, 4 × 24 well plates were prepared. The plates were incubated overnight at 37°C and 5% CO2.           

 

Day 2

            For each transfection experiment, 4 × 24 well plates were prepared. Each 24 well plate consisted of 3 replicates of each construct, together with 3 replicates of each of an empty pGL3E vector and negative controls consisting only of cells and transfection reagent. A separate plate was prepared with 12 replicates of positive control vector.

Using an aseptic technique in a class II safety cabinet, 9 master mixes were prepared for each of the 24 well plates. Each master mix was enough for 3 replicates of each construct (6) and controls (3), plus 5% extra volume for pipetting errors. The master mix consisted of serum and antibiotic free DMEM, pGL3E vector with inserted construct, pRL-SV40 internal control vector and Tfx™-20 reagents. For the negative control, only transfection reagent was added to the serum free medium. These master mixes were prepared as follows, in sterile 1.5ml microcentrifuge tubes. All reagents were first brought to room temperature and serum / antibiotic free medium was pre-warmed at 37°C.

DNA concentrations of each construct and controls were measured by spectrophotometry and diluted to a final concentration of 200 µg/ml (0.2 µg/µl). The DNA concentration was measured again after dilution and adjustments were made as required. The pRL-SV40 was diluted to a concentration of 5 µg/ml (5 ng/µl) so that the same volume as construct/pGL3E will be added to the mix. This will give a ratio of 1:40 of pRL-SV40 to construct/pGL3E (or control), respectively.

 

Transfection of HeLa cells

            In a sterile microcentrifuge tube, 593.2 µl of pre-warmed serum and antibiotic free medium were added followed by the addition of 25.2 µl DNA, consisting of equal volumes of pRL-SV40 and construct/pGL3E prepared as described above. The total amount of DNA added into each well was of 0.82 µg. No DNA was added into those vials to be used as negative controls while the control vector was added to the positive transfection control. The tubes were immediately vortexed and 11.6 µl of Tfx™-20 lipid carrier reagent was added directly into the medium/DNA mixture followed by immediate vortexing. This amount of lipid carrier was enough to give a charge ratio of Tfx™-20 to DNA of 3:1. This mixture was incubated at room temperature for 10 – 15 minutes. This master mix was enough for 3 replicates (+5% extra volume for pipetting errors) of each construct and controls.

            During incubation the medium from the cultured cells was removed carefully by aspiration. Following incubation, the transfection mixture was vortexed briefly and 200 µl were added into each well. The plates were placed in an incubator at 37°C for 1 hour.

            After the incubation, 500 µl of complete medium (DMEM; 10% FCS; 4mM L-glutamine) containing 20 µl extra FCS / well were added gently onto the cells. The transfection medium was not removed from the plates. The cells were placed in the incubator at 37°C with 5% CO2 for 48 hours.

 

Transfection of RAW 264.7 cells

            The day before transfection, 5 × 104 cells were added into each of the 24 well plates in complete medium. All 4 × 24 well plates were incubated for 18 hours at 37°C in 5% CO2. The next day the plates were inspected microscopically, and transfection was performed when the cells were 60 % confluent.

            Transfection was performed as described for HeLa cells but using a total of 1.025µg DNA (1µg plasmid/construct + 25ng pRL-SV40). A 2:1 charge:DNA ratio of Tfx™-20 (Promega, Madison, WI, USA) was used for transfection of RAW 264.7. A master mix for triplicate experiment of each construct and controls was prepared. 584 µl of serum and antibiotic free DMEM were added into a sterile microcentrifuge tube followed by the addition of 15.75 µl of each of the pRL-SV40 and construct/pGL3E DNA followed by immediate vortexing. 14.5 µl of Tfx™-20 transfection reagent were added into each tube followed by vortexing and incubation for 10 – 15 minutes at room temperature. After incubation the medium was removed from each well of cultured cells and 200 µl of transfection mixture were added into each well and incubated at 37°C in 5% CO2. Following 1 hour transfection incubation at 37°C, complete medium containing appropriate stimulants was added into each well. 10% heat deactivated foetal calf serum was used for these experiments. Two sets of transfections were performed, one with the addition of 10ng/ml recombinant mouse M-CSF only and the other with the addition of 10ng/ml M-CSF and 75ng/ml mouse RANKL (R&D Systems Ltd, Abington, UK). Due to increased cell cyto-toxicity following transfection, incubation was performed for 36 hours at 37°C in 5% CO2.

 

 

Dual Luciferase® Reporter Assay

            The dual-luciferase® reporter assay system (Promega, Madisson, WI, USA) provides an efficient way to perform dual reporter assays exploiting the distinct evolutionary origins of firefly and renilla luciferases and their requirements for dissimilar substrates. This makes it possible to discriminate between their respective bioluminescent reactions. In this system, the luminescence of the reporter firefly luciferase is measured first and eventually quenched while simultaneously activating the luminescent reaction of renilla luciferase. Luciferin is oxidised and light is emitted in a reaction that requires ATP, Mg2+ and O2. This will generate a flash of light that rapidly decays after substrate and enzyme are mixed.

 

Passive Lysis of Cells

            A 1X passive lysis buffer (PLB) was prepared by diluting a 5X concentrate in distilled water. Besides the lytic properties, PLB also gives stability and provides optimum performance to the luciferases. After incubation, the culture medium was removed by aspiration and the cells were gently washed by adding 500 µl of phosphate buffered saline (PBS). The PBS was removed by aspiration. 100 µl of 1X PLB were added into each well, enough to cover the cell monolayer, and plates were placed for 15 minutes in an orbital shaker with gentle shaking at room temperature. Following this, the plates were frozen at -80°C until analysed. At this temperature, the luciferases are stable for long periods of time. Also, this step helps to ensure complete lysis of the cells.

 

Luciferase Assay Protocol

            All reagents stored at -20°C were brought to room temperature prior to the analysis, including the cell lysates that were removed from the freezer and placed on an orbital shaker at room temperature. The lyophilised Luciferase Assay Reagent II (LAR II) substrate was re-suspended in 10 ml of LAR II buffer, enough for 100 assays. The Stop & Glo® reagent supplied as a 50X solution was diluted in the corresponding buffer supplied by manufacturer, by adding 200 µl of 50X Stop & Glo® reagent into 10 ml buffer. The assays were performed using a TD-20/20 Luminometer (Turner BioSystems, Sunnyvale, CA, USA) programmed with a 2-second pre-read delay followed by 10 second measurement period for both firefly and renilla luciferases.

            100 µl of LAR II reagent were pre-dispensed into appropriate number of luminometer tubes. 20 µl of cell lysate were added to the LAR II reagent and mixed briefly by pipetting 3 times. The tube was immediately placed into the luminometer and reading was initiated. After the first reading was taken (Firefly luciferase activity), the tube was removed from the luminometer and 100 µl of Stop & Glo® reagent were added to the tube followed by brief vortexing. The tube was immediately placed into the luminometer again and the second reading was taken. Both readings and luciferase/renilla ratio were recorded and the tube was discarded.

 

Analysis of Data

            All luminescence data were recorded for each individual plate and entered into a spreadsheet. The mean value of the firefly luminescence for the three non transfected controls (cells only) was calculated. This mean was subtracted from each firefly luminescent value generated for the same plate in order to correct for background luminescence. A firefly:renilla ratio for each sample was calculated using background corrected values. A mean was also calculated for each triplicate of each individual construct. Each mean firefly:renilla ratio was divided by the ratio of lysates generated from cells that were transfected with an empty pGL3E from the same plate. This generated fold increase of luciferase activity ratios over the expression of cells transfected with promoter less vector.

            The data from the other three plates was analysed in the same way generating 4 sets of data. The mean of the fold values for each construct was calculated together with the standard error of mean. Statistical comparisons between reporter gene expression of different constructs and between mutated and normal alleles were performed using a t-test, and the Bonferroni correction was applied for multiple comparisons.

   
     
BACK HOME FORWARD